Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0000140 | |||
Gene | KIAA0907 | Organism | Human |
Genome Locus | chr1:155891165-155895634:- | Build | hg19 |
Disease | Oral Squamous Cell Carcinoma | ICD-10 | Carcinoma in situ of oral cavity, oesophagus and stomach (D00) |
DBLink | Link to database | PMID | 29991057 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 3 OSCC patients and 3 age- and sex-matched healthy controls |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CCGGCATTACCTACTGGAGTC ReverseCCTTCCACCTTCTCCTTGACA | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Zhao, SY, Wang, J, Ouyang, SB, Huang, ZK, Liao, L (2018). Salivary Circular RNAs Hsa_Circ_0001874 and Hsa_Circ_0001971 as Novel Biomarkers for the Diagnosis of Oral Squamous Cell Carcinoma. Cell. Physiol. Biochem., 47, 6:2511-2521. |